Tender Details
Beyond this tender, use our platform to source any product, service, or solution.
Get direct quotes or register as a qualified provider.
| Particulars | Details |
|---|---|
| Title |
4693159001 Protease Inhibitor Cocktail Tablets Complete Mini Edta Free,T3251 100 G,Pcr Primers Sca
|
| Description |
|
| Organisation | Department of Health Research | Ministry of Health and Family Welfare |
| Tender Id | GEM/2024/B/4436915 |
|
Reference Number |
- |
| Tender Fee | - |
| EMD | - |
| Tender Value | - |
| Place | |
| Link |
View Original Tender Notice
https://bidplus.gem.gov.in/all-bids |
| Start Date | January 04, 2024 23:17 |
| End Date |
Expired
15/01/2024
Expired 1000 days ago |
Tender Support
Get help with filing, GeM registration, documents, or relevant tender alerts.
Award of Contract & Bid Results
Awarded Contractor / Winner
GENEX LIFE SCIENCES PRIVATE LIMITEDEXCELL BIOSOLUTIONSSHRI HARI FINE CHEMSHRI HA...
Tender Status:
active
Additional Information:
Average Turn Over of Last 3 Years: Lakhs
Experience with Gov. Required: Years
Buyer Name:
Konari Rama Rao
Ministry:
Ministry Of Health And Family Welfare
Department:
Department Of Health Research
Organisation:
Indian Council Of Medical Research (icmr)
Technical Evaluation Results
| S.No. | Seller Name | Offered Item | Participated On | MSE/MII Status | Status |
|---|---|---|---|---|---|
| 1 | EXCELL BIOSOLUTIONS | - | 13-01-2024 18:42:22 | MSE | Evaluated |
| 2 | GENEX LIFE SCIENCES PRIVATE LIMITED | - | 15-01-2024 15:33:42 | N/A | Evaluated |
| 3 | SHRI HARI FINE CHEM | - | 12-01-2024 18:58:21 | MSE | Evaluated |
| 4 | SUPERWORTH BIO | - | 13-01-2024 15:16:31 | MSE | Evaluated |
| 5 | SUPERWORTH BIODISCOVERIES PRIVATE LIMITED | - | 15-01-2024 11:34:29 | MSE | Evaluated |
| 6 | VITARA CURE PRIVATE LIMITED | - | 13-01-2024 15:02:07 | N/A | Evaluated |
Ordered Items & Contract Pricing
| Product | Brand | Model | Ordered Quantity | Price |
|---|---|---|---|---|
| 4693159001 Protease inhibitor cocktail tablets - complete mini EDTA free | NA | BOQ Item | 1 | ₹ 20711.870 |
| T3251-100G | NA | BOQ Item | 1 | ₹ 12825.560 |
| PCR primers scale 50nmole bases desalted | NA | BOQ Item | 1000 | ₹ 47200.000 |
| UFC700308 Centricon plus 70 centrifugal filter 3kDA cutoff | NA | BOQ Item | 8 | ₹ 41760.000 |
| SCT123 Gelred nucleic acid stain 10000XWater | NA | BOQ Item | 3 | ₹ 49770.000 |
| Primers for DV23rRNA 23s-1991F 5CCATCTCTTGACTGTCTCGGCTAT3 | NA | BOQ Item | 24 | ₹ 736.320 |
| Primers 23S-2138R5CCTACCTATTCTCTACATGGTGGTGTT3 | NA | BOQ Item | 27 | ₹ 828.360 |
| 04793773001 Probe C111, Set of 2 | NA | BOQ Item | 1 | ₹ 27399.600 |
| 0534462001 Lamp halogen 12V Power Assay | NA | BOQ Item | 1 | ₹ 11127.400 |
| 4838181001 Ist Deproteinizer | NA | BOQ Item | 1 | ₹ 1424.850 |
| 12172623122 CFAS lipids calibrators 3x1ml | NA | BOQ Item | 1 | ₹ 7020.720 |
| 4718917190 Cholestrol for cobas C111 400 tests | NA | BOQ Item | 1 | ₹ 2881.200 |
| 11706802001 Assaycup Elecsys2010 Cobas ey11 3600 | NA | BOQ Item | 1 | ₹ 8736.000 |
| 11706799001 Assay tip Elecsys 2010 cobas ey11 3600 | NA | BOQ Item | 1 | ₹ 8870.000 |
| 4357108001 curvette segments cobas c111 1680 | NA | BOQ Item | 1 | ₹ 5104.680 |
| 4657594190 Triglycerides for cobas c111 200tests | NA | BOQ Item | 1 | ₹ 2763.600 |
| 7528604190 HDL cholestrol for cobas C111 200 tests | NA | BOQ Item | 1 | ₹ 10448.760 |
Similar Tenders
Complete edta free protease inhibitor cocktail,trizma,hepes buffer,acrylamide,glycine,inner glass p
Read more
Immobilon-p 265mm x 1875mm roll,complet mini edta-free protease inhibitor cocktail,invitrogen super
Read more
Immobilon-p 265mm x 1875mm roll,complet mini edta-free protease inhibitor cocktail,invitrogen super
Read more
Immobilin p transfer membrane,trypsin edta solution,protease inhibitor cocktail,fetal bovine serum,
Read more
Protease inhibitor cocktail,trehalose, dihydrate,2-morpholinoethanesulfonic acid monohydrate,tris b
Read more
Diethyl pyrocarbonate depc,rneasezap,protease and phosphatase inhibitor cocktail,tris 2 carboxyethy
Read more
Click
Here to Download Dockets
of your Industry type
of your Industry type