Tender Details
Check your funding eligibility in 2 minutes.
Answer a few questions and our team will contact you with your best options.
Particulars | Details |
---|---|
Title |
4693159001 Protease Inhibitor Cocktail Tablets Complete Mini Edta Free,T3251 100 G,Pcr Primers Sca
|
Description |
|
Organisation | Department of Health Research | Ministry of Health and Family Welfare |
Tender Id | GEM/2024/B/4436915 |
Reference Number |
|
Tender Fee | |
EMD | |
Tender Value | |
Place | |
Link | https://bidplus.gem.gov.in/all-bids |
Start Date | January 04, 2024 23:17 |
End Date |
15/01/2024 ( Expired 523 days ago ) Search Similar tenders? |
Join for More Relevant Opportunities |
S.No. | Seller Name | Offered Item | Participated On | MSE/MII Status | Status |
---|---|---|---|---|---|
1 | EXCELL BIOSOLUTIONS | - | 13-01-2024 18:42:22 | MSE | Evaluated |
2 | GENEX LIFE SCIENCES PRIVATE LIMITED | - | 15-01-2024 15:33:42 | N/A | Evaluated |
3 | SHRI HARI FINE CHEM | - | 12-01-2024 18:58:21 | MSE | Evaluated |
4 | SUPERWORTH BIO | - | 13-01-2024 15:16:31 | MSE | Evaluated |
5 | SUPERWORTH BIODISCOVERIES PRIVATE LIMITED | - | 15-01-2024 11:34:29 | MSE | Evaluated |
6 | VITARA CURE PRIVATE LIMITED | - | 13-01-2024 15:02:07 | N/A | Evaluated |
Contract Details
- Contract Status:
- Fullfillment in Progress Fullfillment in Progress Order Completed Fullfillment in Progress Order Accepted Fullfillment in Progress Order Accepted Order Accepted Order Accepted Order Accepted
- Seller:
- GENEX LIFE SCIENCES PRIVATE LIMITEDEXCELL BIOSOLUTIONSSHRI HARI FINE CHEMSHRI HARI FINE CHEMGENEX LIFE SCIENCES PRIVATE LIMITEDVITARA CURE PRIVATE LIMITEDVITARA CURE PRIVATE LIMITEDVITARA CURE PRIVATE LIMITEDVITARA CURE PRIVATE LIMITEDVITARA CURE PRIVATE LIMITED
- Buyer Designation:
- ASSISTANTASSISTANTASSISTANTASSISTANTASSISTANTASSISTANTASSISTANTASSISTANTASSISTANTASSISTANT
- Buying Mode:
- Bid/RABid/RABid/RABid/RABid/RABid/RABid/RABid/RABid/RABid/RA
- Contract Date:
- 2024-02-13 21:34:00 +0530
- Contract Amount:
Product | Brand | Model | Ordered Quantity | Price |
---|---|---|---|---|
4693159001 Protease inhibitor cocktail tablets - complete mini EDTA free | NA | BOQ Item | 1 | ₹ 20711.870 |
T3251-100G | NA | BOQ Item | 1 | ₹ 12825.560 |
Product | Brand | Model | Ordered Quantity | Price |
PCR primers scale 50nmole bases desalted | NA | BOQ Item | 1000 | ₹ 47200.000 |
Product | Brand | Model | Ordered Quantity | Price |
UFC700308 Centricon plus 70 centrifugal filter 3kDA cutoff | NA | BOQ Item | 8 | ₹ 41760.000 |
Product | Brand | Model | Ordered Quantity | Price |
SCT123 Gelred nucleic acid stain 10000XWater | NA | BOQ Item | 3 | ₹ 49770.000 |
Product | Brand | Model | Ordered Quantity | Price |
Primers for DV23rRNA 23s-1991F 5CCATCTCTTGACTGTCTCGGCTAT3 | NA | BOQ Item | 24 | ₹ 736.320 |
Primers 23S-2138R5CCTACCTATTCTCTACATGGTGGTGTT3 | NA | BOQ Item | 27 | ₹ 828.360 |
Product | Brand | Model | Ordered Quantity | Price |
04793773001 Probe C111, Set of 2 | NA | BOQ Item | 1 | ₹ 27399.600 |
0534462001 Lamp halogen 12V Power Assay | NA | BOQ Item | 1 | ₹ 11127.400 |
4838181001 Ist Deproteinizer | NA | BOQ Item | 1 | ₹ 1424.850 |
Product | Brand | Model | Ordered Quantity | Price |
12172623122 CFAS lipids calibrators 3x1ml | NA | BOQ Item | 1 | ₹ 7020.720 |
4718917190 Cholestrol for cobas C111 400 tests | NA | BOQ Item | 1 | ₹ 2881.200 |
Product | Brand | Model | Ordered Quantity | Price |
11706802001 Assaycup Elecsys2010 Cobas ey11 3600 | NA | BOQ Item | 1 | ₹ 8736.000 |
11706799001 Assay tip Elecsys 2010 cobas ey11 3600 | NA | BOQ Item | 1 | ₹ 8870.000 |
Product | Brand | Model | Ordered Quantity | Price |
4357108001 curvette segments cobas c111 1680 | NA | BOQ Item | 1 | ₹ 5104.680 |
Product | Brand | Model | Ordered Quantity | Price |
4657594190 Triglycerides for cobas c111 200tests | NA | BOQ Item | 1 | ₹ 2763.600 |
7528604190 HDL cholestrol for cobas C111 200 tests | NA | BOQ Item | 1 | ₹ 10448.760 |
Diethyl pyrocarbonate depc,rneasezap,protease and phosphatase inhibitor cocktail,tris 2 carboxyethy
Read more
Boron free corrosion inhibitor for locomotive engine cooling water system to hp power kool rr, quantity 187 ltrs per loco set, as per rdso report no.mp.misc-184, rev.00 (dec 06) and rdso s specification no.mp2.99.00.03 (rev-latest) and rdso report no. mp.mi-15 (revision-13), may 2023
For complete deion and other details, please refer to tender
Read moreNon-chromate, boron free corrosion inhibitor for alco diesel locomotives
For complete deion and other details, please refer to tender
Read moreFluo 4 am,saponin 25g,protease inhibitor cocktail,aaph- 2 2-azobis 2-methyl propinamidine dihydroch
Read more
Procurement of boron free corrosion inhibitor and engine coolant hp power kool rr to rdso s spec. no. mp. m i-15 (rev.13). shelf life 12-18 months.
For complete deion and other details, please refer to tender
Read moreNon-chromate boron free corrosion inhibitor percent a0for engine coolant water treatment of alco locos. hp power kool rr of m/s. hpcl to rdso. maintenance instruction no.mp.mi -15 (rev.13) may-2023 of pg no.4, s.no.1 percent a0. percent a0 percent a0(approved.coolant)
For complete deion and other details, please refer to tender
Read more11836153001 complete mini protease inhibitor cocktail,141906 apc anti-muse tlr3 100ug,103128 alexa
Read more
I.v. drip set for chemotherapy (0.2 micron i.v filter, mfg. by dehp free material) dispo.
For complete deion and other details, please refer to tender
Read moreStimulant laxatives emulsion containing atleast milk of magnesia 11.25ml., liquid paraffin 3.75ml./15ml.sugar free in min. 170ml. bottle
For complete deion and other details, please refer to tender
Read moreNon-chromate boron free corrosion inhibitor percent a0for engine coolant water treatment of alco locos. hp power kool rr of m/s. hpcl to rdso. maintenance instruction no.mp.mi -15 (rev.13) may-2023 of pg no.4, s.no.1 percent a0. percent a0 percent a0(approved.coolant)
For complete deion and other details, please refer to tender
Read moreof your Industry type