Tender Details
Beyond this tender, use our platform to source any product, service, or solution.
Get direct quotes or register as a qualified provider.
| Particulars | Details |
|---|---|
| Title |
Alt R Crispr Cas9 Sg Rna,Alt R Crispr Cas9 Cr Rna (Fla G1: Ctaggaggtgaatctctcgt),Alt R Crispr Cas9 C
|
| Description |
|
| Organisation | Department of Agricultural Research and Education (DARE) | Ministry of Agriculture and Farmers Welfare |
| Tender Id | GEM/2024/B/5416486 |
|
Reference Number |
|
| Tender Fee | |
| EMD | |
| Tender Value | |
| Place | |
| Link |
View Original Tender Notice
https://bidplus.gem.gov.in/all-bids |
| Start Date | October 03, 2024 16:33 |
| End Date |
Expired
24/10/2024
Expired 619 days ago |
Tender Support
Get help with filing, GeM registration, documents, or relevant tender alerts.
382/25-26-thrissur corporation ayyanthole zonal2025-26 division 48 r e c o n s t r u c t i o n n e w construction of drain and cover slab at
382/25-26-thrissur&#x0d corporation ayyanthole&#x0d zonal2025-26 division 48&#x0d r e c o n s t r u c t i o n n e w&#x0d construction of drain and cover&#x0d slab at
Read moreGeneral-repair and maintenance works to wireless police telecommunication quarters ,iii and iv type quarters-repair and m a i n t e n a n c e w o r k s t o p o l i c e telecommunication quarters , iii and iv type quarters -general civil work
Repair and maintenance works
Read moreAlt-r crispr-cas9 crrna,alt-r crispr-cas9 crrna,alt-r crispr-cas9 crrna,alt-r crispr-cas9 crrna,alt
Read more
Alt-r crispr-cas9 crrna (sbe1 g1: taatactccaaacaccaaac),alt-r crispr-cas9 crrna (sbe1 g2: tcaaacatg
Read more
Alt-r crispr cas9crrna,alt-r crispr-cas9 crrna,alt-r crispr-cas9crrna,alt-r crispr-cas9 crrna,alt-r
Read more
Alt-r crispr cas9crrna,alt-r crispr-cas9 crrna,alt-r crispr-cas9crrna,alt-r crispr-cas9 crrna,alt-r
Read more
Alt-r-crispr-cas9 sgrna,alt-crispr-cas9crrna(fla_ gl: ctaggaggtgaatctctcgt,alt-rcrispr-cas9crrna(fl
Read more
Acti staintm 488,dock8 crispr by cas9 ko plasmid h,integrin i 2 itgb2 or cd18 crispr by cas9 ko pla
Read more
of your Industry type