Results for: primers

Find the latest primers tenders from different organizations. SigmaTenders helps you participate in these online e-Procurement tenders. We provide access to tender details, BOQs, and technical bids, along with bidding support for primers e-tenders. Get matching tenders on WhatsApp, with coverage across government websites, GeM and e-Procurement portals.

Southgaard primer vg-27(light yellow),thinner for southgaard primer vg-27

Organisation: Department of Defence Production | Ministry of Defence

Start Date: July 10, 2025 21:13

Due Date: Expired 468 days ago

Contract Awarded

Fvl forward primer tgcccagtgcttaacaagacca sigma merck,fvl reverse primer cttgaaggaaatgccccatta 21,r

Organisation: Department of Health Research | Ministry of Health and Family Welfare

Start Date: February 07, 2024 17:28

Due Date: Expired 996 days ago

Top coat high durability polyurethene ca40000,epoxy primer pr143,etch primer pr30b

Organisation: Department of Defence | Ministry of Defence

Start Date: September 20, 2024 21:51

Due Date: Expired 761 days ago

Epoxy red oxide primer to ncd - 1435,compatible thinner for epoxy primer

Organisation: Department of Defence Production | Ministry of Defence

Start Date: October 01, 2024 21:24

Due Date: Expired 749 days ago

Contract Awarded

Top coat high durability polyurethene ca40000,epoxy primer pr143,etch primer pr30b

Organisation: Department of Defence | Ministry of Defence

Start Date: October 29, 2024 22:30

Due Date: Expired 742 days ago

Contract Awarded

Etch primer yellow color for aviation,thinner for etch primer for aviation

Organisation: INDIAN OIL CORPORATION LIMITED | Ministry of Petroleum and Natural Gas

Start Date: December 24, 2024 20:20

Due Date: Expired 677 days ago

Epoxy paint and primer

Tender EMD: 0

Tender Fee: 0

Organisation: Bharat Heavy Electricals Limited | Public Sector Undertakings

Start Date: August 22, 2025 18:30

Place: Bhel bhopal

Due Date: Expired 445 days ago

Primer for lhb coaches

For complete deion and other details, please refer to tender

Tender EMD: 0

Tender Fee: 0

Organisation: Ministry of Railways | Central Govt. Ministry/Department

Start Date: September 01, 2025 00:14

Place: Mumbai cst

Due Date: Expired 427 days ago

Procurement of primer coating

Organisation: Indian Air Force | Department of Military Affairs

Start Date: October 05, 2026 15:07

Place: West bengal

Due Date: Expired 16 days ago

Primer-7471 or equivalent

For complete description and other details, please refer to tender document.

Organisation: Ministry of Railways

Start Date: September 25, 2026 23:13

Due Date: Expired 9 days ago

Get new primers tenders

Tell us what you supply or do. We'll send you matching tenders on WhatsApp and call you about them.

Free tender checklists for your industry →

Can't meet a tender's eligibility alone? Find a JV or local partner →

Need help bidding on these tenders?

Our team helps with GeM registration, eligibility, tender documents, compliance and bid submission.

Get bid support