Tender Details

This tender closed on 14 Jun 2024.

Get alerts for new ones See who won

About Tender

🔬 Procurement Opportunity For N5751 5 G L Name 5 Gm Nw Nitro L Arginine Methyl Ester Hydrochloride 💉 The Department Of Health Research, Under The Ministry Of Health And Family Welfare, Is Seeking Bids For The Supply Of N5751 5 G L Name 5 Gm Nw Nitro L Arginine Methyl Ester Hydrochloride, Along With Precision Plus Protein. 📅 Bid Submission Deadline: June 14, 2024, 1:00 Pm This Procurement Is For Scientific Research Purposes And Requires Suppliers To Provide Detailed Bids, Including Specifications, Pricing, And Delivery Schedules, In Accordance With The Regulatory Standards For Pharmaceutical Products. Keywords: N5751 5 G, L Arginine Methyl Ester Hydrochloride, Precision Plus Protein, Health Research, Ministry Of Health And Family Welfare, Procurement, Pharmaceutical Supplies
Title
N5751 5 G L Name 5gm Nw Nitro L Arginine Methyl Ester Hydrochloride,1610377 Precision Plus Protein
Description
Organisation Department of Health Research | Ministry of Health and Family Welfare
Tender Id GEM/2024/B/4976689
Reference
Number 		-
Tender Fee -
EMD -
Tender Value -
Place
Link
View Original Tender Notice

https://bidplus.gem.gov.in/all-bids
Start Date May 24, 2024 18:10
End Date
Expired 14/06/2024

Expired 876 days ago

Similar tenders

Bidding on tenders like this?

Partners, bid preparation, supplier quotes and GeM registration, from our team and partners.

Get bid preparation help
Supplier quotes GeM registration How to file a tender
WhatsApp support Join our WhatsApp channel Execution support via GetSaarthi

Award of Contract & Bid Results

Awarded Contractor / Winner

GENEX LIFE SCIENCES PRIVATE LIMITEDGENETIX BIOTECH ASIA PRIVATE LIMITEDSHIVEN BI...

Tender Status: active
Additional Information: Average Turn Over of Last 3 Years: Lakhs Experience with Gov. Required: Years
Buyer Name: Konari Rama Rao
Ministry: Ministry Of Health And Family Welfare
Department: Department Of Health Research
Organisation: Indian Council Of Medical Research (icmr)

Technical Evaluation Results

S.No. Seller Name Offered Item Participated On MSE/MII Status Status
1 CELLTECH BIOSCIENCES LLP - 11-06-2024 14:08:39 MSE Evaluated
2 E-NNOVATION LIFE SCIENCES - 10-06-2024 15:36:52 MSE Evaluated
3 ELECTROCRAFTS - 29-05-2024 13:25:59 N/A Evaluated
4 EXCELL BIOSOLUTIONS - 12-06-2024 16:09:47 MSE Evaluated
5 GENETIX BIOTECH ASIA PRIVATE LIMITED - 13-06-2024 17:10:59 N/A Evaluated
6 GENEX LIFE SCIENCES PRIVATE LIMITED - 12-06-2024 22:47:46 N/A Evaluated
7 RENWIK BIOINNOVATIONS PRIVATE LIMITED - 13-06-2024 13:52:41 N/A Evaluated
8 SB Biochem - 14-06-2024 12:56:42 MSE Evaluated
9 SHIVEN BIOTECH - 01-06-2024 15:20:39 N/A Evaluated
10 SUPERWORTH BIO - 10-06-2024 14:12:13 MSE Evaluated
11 SUPERWORTH BIODISCOVERIES PRIVATE LIMITED - 10-06-2024 17:30:02 MSE Evaluated

Ordered Items & Contract Pricing

Product Brand Model Ordered Quantity Price
N5751-5G L-Name 5gm Nw-Nitro- L-Arginine Methyl ester Hydrochloride NA BOQ Item 1 ₹ 15642.940
1610377 Precision plus Protein Dual Xtra Prestained Protein standards 500ul NA BOQ Item 2 ₹ 19766.880
E-EL-R0026 Rat Leutinizing Hormone LH ELISA Kit 96 TESTS NA BOQ Item 2 ₹ 39900.000
E-EL-R0391 Rat Follicle Stimulating Hormone FSH ELISA Kit 96 tests NA BOQ Item 2 ₹ 39900.000
E-EL-0154 Progesterone ELISA Kit 96 Tests NA BOQ Item 2 ₹ 39900.000
E-EL-R3006 Rat Prolactin Hormone PRL ELISA Kit 96 Kit NA BOQ Item 2 ₹ 39900.000
07J68-001 Thermobrite Humidity Strips NA BOQ Item 1 ₹ 12544.000
A12216 Amplex Red cholestrol NA BOQ Item 1 ₹ 34524.970
A22189 Amplex Red Glucose 1GU NA BOQ Item 1 ₹ 33698.910
A12221 Amplex Red Glutamic AC NA BOQ Item 1 ₹ 31552.850
A22188 Amplex Red Hydrogen PE NA BOQ Item 1 ₹ 32598.270
A33855 Amplex Red Ultra red stop Reagent NA BOQ Item 1 ₹ 9453.990
Q32856 Qubit Assay Tubes set of 500 NA BOQ Item 1 ₹ 7753.600
Custom morpholino 5CTCCAGCCCAGTCTGCCCATCGAG3 Carboxyfluorescein 300nmol NA BOQ Item 1 ₹ 106766.400
Standard Control Oligo - 3 fluorescein 300nmol NA BOQ Item 1 ₹ 106766.400
EK-075-40 LEAP-2 38-77 ELISA KIT NA BOQ Item 1 ₹ 81312.000
MB228-500ML NA BOQ Item 20 ₹ 46300.000
61808 Pyridine 500ml NA BOQ Item 1 ₹ 952.000

Get alerts for tenders like this

This one has closed. Tell us what you supply and we'll send you new tenders like it.

Free tender checklists for your industry →

Similar Tenders